Skip to main content

A case of Shwachman–Diamond syndrome

Shwachman–Diamond syndrome (SDS) is an autosomal recessive disorder (OMIM 260400), characterized by exocrine pancreatic insufficiency, skeletal abnormalities and bone marrow (BM) dysfunction, with a risk, as high as 30%, to develop myelodysplastic syndrome and/or acute myeloid leukaemia (MDS/AML). The SBDS gene (OMIM 607744) is localized on chromosome 7 at the band q11 and mutations of this gene are found in 90% of patients.

Direct sequencing of whole exon 2 and flanking intronic regions of the SBDS gene was performed on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, USA) using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). The forward (F) and reverse (R) primers for amplifying exon 2 are AAATGGTAAGGCAAATACGG (2Fa), AGACCTCGATGAAGTTCT-GC (2Fb) and ACCAAGTTCTTTATTATTAGAAGTGAC (2R).

We described a 14 years old boy who presented with skeletal system abnormalities (Legg-Calve-Perthes syndrome, congenital coxa vara and genu valgum deformity), short stature, chronic dydpepsia, neutropenia and thrombocytopenia. Abdominal CT of patient showed congenital lipomatosis of pancreas and spine bone density shows osteoporosis. Direct sequencing for whole exons including intron-exon boundaries of patient showed two heterozygous mutations, c. [183_184TA>CT] + [258+2T>C].

We treated the patient with pancreatin (Now Foods Pancreatin 1T=Lipase 9,000/Amylase 50,000/Protease 50,000 USP units) and Dicamax (1T=Ca. carbonate 1,250 mg and cholecalciferol 1,000 IU). We has observed for hematologic abnormality and prepared for bone marrow transplantation.

We report a child with diverse clinical manifestations of SDS including short stature, chronic dydpepsia, skeletal system abnormalities, and neutropenia; the clinical diagnosis was confirmed by genetic analysis for the second time in Korea.

Author information



Corresponding author

Correspondence to Ji Hoon Kim.

Rights and permissions

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and Permissions

About this article

Cite this article

Kim, J.H., Cho, W.K., Kim, T. et al. A case of Shwachman–Diamond syndrome. Int J Pediatr Endocrinol 2013, P43 (2013).

Download citation


  • Cholecalciferol
  • Lipase
  • Short Stature
  • Acute Myeloid Leukaemia
  • Pancreatic Insufficiency